SEMA4D

Ensembl ID:
ENSDARG00000067801
Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Human Orthologue:
SEMA4D
Human Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se
Mouse Orthologue:
Sema4d
Mouse Description:
sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (se

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43565 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097664 Nonsense 179 860 8 17
Genomic Location (Zv9):
Chromosome 21 (position 3337841)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2779179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATCTGTGTTTGTTGTTCAGATGGCGAGTTGTACTCAGGAACTGCTTA[T/G]AACTTTCTGGGCAGTGAACCGATCATCTCCAGATCGTCTCCGTCTCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link