ppapdc1a

Ensembl ID:
ENSDARG00000067798
ZFIN ID:
ZDB-GENE-081107-53
Description:
Novel protein similar to vertebrate phosphatidic acid phosphatase type 2 domain containing 1 family
Human Orthologue:
PPAPDC1A
Human Description:
phosphatidic acid phosphatase type 2 domain containing 1A [Source:HGNC Symbol;Acc:23531]
Mouse Orthologue:
Ppapdc1a
Mouse Description:
phosphatidic acid phosphatase type 2 domain containing 1A Gene [Source:MGI Symbol;Acc:MGI:2685936]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38916 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44781 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097656 Essential Splice Site 136 263 4 6
ENSDART00000132111 Essential Splice Site 63 190 2 4
Genomic Location (Zv9):
Chromosome 13 (position 2672835)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2494403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCTGGTGTCTGAGGGCCGCAAGAGTTTTCCTAGCAGTCATTCGTCCT[G/T]TAAGTACTCAGTGTGTTACCAATTTTGTCTGTCTTATTTTTATTAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097656 Nonsense 207 263 6 6
ENSDART00000132111 Nonsense 134 190 4 4
Genomic Location (Zv9):
Chromosome 13 (position 2635474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTCACAGATGCTTTTGTCGGGGGAGTGATCGGCCTGTTCTTCGCCTA[C/A]ATCTGTTATCGGCAGCACTACCCGCCGTTCCTGCACATAGACTGCCACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link