LOC100332309

Ensembl ID:
ENSDARG00000067796
Human Orthologue:
CLPX
Human Description:
ClpX caseinolytic peptidase X homolog (E. coli) [Source:HGNC Symbol;Acc:2088]
Mouse Orthologue:
Clpx
Mouse Description:
caseinolytic peptidase X (E.coli) Gene [Source:MGI Symbol;Acc:MGI:1346017]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31114 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38141 Nonsense Available for shipment Available now
sa30306 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30305 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30304 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097649 Essential Splice Site 70 618 2 14
Genomic Location (Zv9):
Chromosome 25 (position 36684040)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35091656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTCTCCTCTAAAGAGAGTCCACCGAGAGACGGAGACGGCGGGAAG[G/A]TGCGTTTGTTCTGTCTGTGCTTAAATGAGTGTTTGAAGACTCTAGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097649 Nonsense 129 618 4 14
Genomic Location (Zv9):
Chromosome 25 (position 36679181)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35086797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGGTTTGTCAAATGTGAGAAGTGCCATCATTTCTTCGTGGTTCTGTCC[G/T]AAACCGACTCCAAAAAGGGCCTGAATAAGGAGACGGAGAGTTCAGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097649 Essential Splice Site 160 618 4 14
Genomic Location (Zv9):
Chromosome 25 (position 36679084)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35086700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGTTAAATTCGCTTTAGCTCAGAAACCTCCTCCACCGCCCAAAAAGG[T/C]ACCGCAGCTTCCCACCAGAGCTCACACAAAAGCGGACAATTCGGTCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097649 Essential Splice Site 214 618 6 14
Genomic Location (Zv9):
Chromosome 25 (position 36677962)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35085578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTTTACATGTGGTGGTGAGAGTCGGTTTACTGTCCTTCTGTCCACA[G/A]AGTTGGAGATCAGAAGACGGGAAGATGAATACAGGTTTACAAGTAAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097649 Essential Splice Site 287 618 7 14
Genomic Location (Zv9):
Chromosome 25 (position 36675417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35083033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAAACTGGAGAAGAGCAACATTGTGTTGCTGGGACCCACTGGATCAGG[T/C]CGGTGCTGGTTTTATTTATGTTTCCATTATTTATAGCACCAACAATTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link