crfb6

Ensembl ID:
ENSDARG00000067795
ZFIN ID:
ZDB-GENE-030131-5999
Description:
cytokine receptor family member b6 [Source:RefSeq peptide;Acc:NP_001071095]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20516 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097648 Essential Splice Site 17 316 None 7

The following transcripts of ENSDARG00000067795 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 47505562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACCTATATAATTCACCTAACGGTTTTCATGTTGATCGTCAATATCGG[T/A]AAGGACTTGAGATAGTTTGTGGCGTTGTCGGGACCGTTATATCTGATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x37w3xiv