LOC100331426

Ensembl ID:
ENSDARG00000067785
Human Orthologue:
PARD3B
Human Description:
par-3 partitioning defective 3 homolog B (C. elegans) [Source:HGNC Symbol;Acc:14446]
Mouse Orthologue:
Pard3b
Mouse Description:
par-3 partitioning defective 3 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1919301]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13435 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097632 Nonsense 995 1023 20 20
Genomic Location:
Chromosome 1 (position 4674790)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGCCAGAGAGCCACCGCGATATGAGGCGCTAAACCAGGGCAACTAC[C/T]GAACGGCCAGTCCYGACCGCTACAGCCCATACACAGATGAACAATATCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • AIDS progression: Genome-wide association study implicates PARD3B-based AIDS restriction. (View Study)
  • Autism: Individual common variants exert weak effects on the risk for autism spectrum disorderspi. (View Study)
  • Knee osteoarthritis: Genome-wide association scan identifies a prostaglandin-endoperoxide synthase 2 variant involved in risk of knee osteoarthritis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y4wrzxaj