si:dkey-20h16.3

Ensembl ID:
ENSDARG00000067730
ZFIN ID:
ZDB-GENE-081030-19
Description:
Novel protein similar to H.sapiens transient receptor potential cation channel, subfamily C [Source:
Human Orthologue:
TRPC6
Human Description:
transient receptor potential cation channel, subfamily C, member 6 [Source:HGNC Symbol;Acc:12338]
Mouse Orthologue:
Trpc6
Mouse Description:
transient receptor potential cation channel, subfamily C, member 6 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5914 Nonsense Mutation detected in F1 DNA During 2017
sa43162 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097547 Nonsense 329 840 3 11
ENSDART00000136471 Nonsense 312 697 3 8
ENSDART00000146926   None 64 None 2
Genomic Location (Zv9):
Chromosome 18 (position 40178346)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41788117
KASP Assay ID:
554-3740.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATCTCTGCCTGCTTCCCACACAGTTTGTAGCCCATCCAAACTGCCAA[C/T]AGCAGCTTTTGTCCATATGGTATGAGAATCTGTCTGGGCTCAGGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097547 Essential Splice Site 677 840 7 11
ENSDART00000136471 Essential Splice Site 660 697 7 8
ENSDART00000146926   None 64 None 2
Genomic Location (Zv9):
Chromosome 18 (position 40200618)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41810389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCAACATGCTCATCGCTATGATCAACAACTCATTTCAGGAAATTGAG[G/A]TAATCACATTCTGAAATGAGATCTGTAAAACGACCAGACATTTGGATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link