LOC100330974

Ensembl ID:
ENSDARG00000067727
Human Orthologue:
BCL11B
Human Description:
B-cell CLL/lymphoma 11B (zinc finger protein) [Source:HGNC Symbol;Acc:13222]
Mouse Orthologue:
Bcl11b
Mouse Description:
B-cell leukemia/lymphoma 11B Gene [Source:MGI Symbol;Acc:MGI:1929913]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39268 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097543 Nonsense 168 794 3 3
Genomic Location (Zv9):
Chromosome 20 (position 4487927)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4281803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCTGCACCACTTGTAAGCAACCCTTTACGAGTGCGTGGTTTCTGCTG[C/T]AGCATGCACAGAACACCCATGGGATACGCATCTACCTGGACACCCACCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aortic stiffness: Common genetic variation in the 3'-BCL11B gene desert is associated with carotid-femoral pulse wave velocity and excess cardiovascular disease risk: the AortaGen Consortium. (View Study)
  • Corneal curvature: Genetic variants near PDGFRA are associated with corneal curvature in Australians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link