A1L2F1_DANRE

Ensembl ID:
ENSDARG00000067701
Description:
LOC100148802 protein [Source:UniProtKB/TrEMBL;Acc:A1L2F1]
Human Orthologue:
MYOZ3
Human Description:
myozenin 3 [Source:HGNC Symbol;Acc:18565]
Mouse Orthologue:
Myoz3
Mouse Description:
myozenin 3 Gene [Source:MGI Symbol;Acc:MGI:2179296]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22401 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111141 Nonsense 64 263 4 7
Genomic Location:
Chromosome 14 (position 926714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCGTTCCTCGAGATGTGATGATGGAGGAGCTGAACCTGAACACAAAC[A/T]GAGGATCCATCATGTTTCAGGAGCGCCAGAGGAGAGTGGAGAGATTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zpccqci0