PDE1C (2 of 2)

Ensembl ID:
ENSDARG00000067683
Description:
phosphodiesterase 1C, calmodulin-dependent 70kDa [Source:HGNC Symbol;Acc:8776]
Human Orthologue:
PDE1C
Human Description:
phosphodiesterase 1C, calmodulin-dependent 70kDa [Source:HGNC Symbol;Acc:8776]
Mouse Orthologue:
Pde1c
Mouse Description:
phosphodiesterase 1C Gene [Source:MGI Symbol;Acc:MGI:108413]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37923 Nonsense Mutation detected in F1 DNA During 2017
sa37924 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7310 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097488 Nonsense 13 487 1 25
Genomic Location (Zv9):
Chromosome 24 (position 33559692)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32438710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTAATCGAATTGTCTTTTTCCATTTCAGACTGAGATGTTTGGTGAAG[C/T]AATTGGAGAGAGGGGAGGCTTCTGTTGTCGACTTGAAGAAAAACCTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097488 Essential Splice Site 129 487 4 25
Genomic Location (Zv9):
Chromosome 24 (position 33565697)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32444715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAACATAAATATGCAGCTACTCTGAATATAAATGTATTTTAGAATGTT[T/A]AAAAAAAAAAAAACACTGCTTTACATTGAATTCCAATGTTAACATGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097488 Nonsense 306 487 16 25
Genomic Location (Zv9):
Chromosome 24 (position 33570441)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32449459
KASP Assay ID:
554-4741.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTATGATYCTTCAGAAATCATTYTTATAGGAAAAATGCATAGATTTT[T/A]GGATCAGATCCGGTTGTAAAARTATATTAAAAATAATATATAAAATATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link