Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
PDE1C (2 of 2)
- Ensembl ID:
- ENSDARG00000067683
- Description:
- phosphodiesterase 1C, calmodulin-dependent 70kDa [Source:HGNC Symbol;Acc:8776]
- Human Orthologue:
- PDE1C
- Human Description:
- phosphodiesterase 1C, calmodulin-dependent 70kDa [Source:HGNC Symbol;Acc:8776]
- Mouse Orthologue:
- Pde1c
- Mouse Description:
- phosphodiesterase 1C Gene [Source:MGI Symbol;Acc:MGI:108413]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa37923 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa37924 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa7310 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa37923
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000097488 | Nonsense | 13 | 487 | 1 | 25 |
- Genomic Location (Zv9):
- Chromosome 24 (position 33559692)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 32438710 GRCz11 24 32353353 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCCTAATCGAATTGTCTTTTTCCATTTCAGACTGAGATGTTTGGTGAAG[C/T]AATTGGAGAGAGGGGAGGCTTCTGTTGTCGACTTGAAGAAAAACCTAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37924
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000097488 | Essential Splice Site | 129 | 487 | 4 | 25 |
- Genomic Location (Zv9):
- Chromosome 24 (position 33565697)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 32444715 GRCz11 24 32359358 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATAACATAAATATGCAGCTACTCTGAATATAAATGTATTTTAGAATGTT[T/A]AAAAAAAAAAAAACACTGCTTTACATTGAATTCCAATGTTAACATGAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7310
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000097488 | Nonsense | 306 | 487 | 16 | 25 |
- Genomic Location (Zv9):
- Chromosome 24 (position 33570441)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 32449459 GRCz11 24 32364102 - KASP Assay ID:
- 554-4741.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTCTATGATYCTTCAGAAATCATTYTTATAGGAAAAATGCATAGATTTT[T/A]GGATCAGATCCGGTTGTAAAARTATATTAAAAATAATATATAAAATATAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Endometriosis: Genome-wide association study link novel loci to endometriosis. (View Study)
- Presence of antiphospholipid antibodies: Genome-wide association study of antiphospholipid antibodies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
