plcl1

Ensembl ID:
ENSDARG00000067676
ZFIN ID:
ZDB-GENE-090313-194
Description:
Novel protein similar to vertebrate phospholipase C-like 1 (PLCL1) [Source:UniProtKB/TrEMBL;Acc:B8JI
Human Orthologue:
PLCL1
Human Description:
phospholipase C-like 1 [Source:HGNC Symbol;Acc:9063]
Mouse Orthologue:
Plcl1
Mouse Description:
phospholipase C-like 1 Gene [Source:MGI Symbol;Acc:MGI:3036262]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31726 Nonsense Available for shipment Available now
sa21517 Essential Splice Site Available for shipment Available now
sa41457 Nonsense Mutation detected in F1 DNA During 2017
sa34681 Nonsense Mutation detected in F1 DNA During 2017
sa2490 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa31726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097475 Nonsense 244 1137 2 8
ENSDART00000136894   None 464 None 6
ENSDART00000144608 Nonsense 252 578 2 3
Genomic Location (Zv9):
Chromosome 9 (position 33466021)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32621967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAACTGGTTGGTGGCTGAGTTTGCTCTGGTTGATGAGGATGGACAC[G/T]GAATTGTGTCTGAAGATACAGCAGTGGCCACCATCTGTAAACTCTGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097475 Essential Splice Site 266 1137 2 8
ENSDART00000136894   None 464 None 6
ENSDART00000144608 Essential Splice Site 274 578 2 3
Genomic Location (Zv9):
Chromosome 9 (position 33466091)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32622037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGTGGCCACCATCTGTAAACTCTGCCCTGGCATTAAAGAAGCAAAGG[T/C]AACACGTTCTCTTATAATTAATTACATTAACCACAACAACTTGCATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097475 Nonsense 384 1137 3 8
ENSDART00000136894   None 464 None 6
ENSDART00000144608 Nonsense 392 578 3 3
Genomic Location (Zv9):
Chromosome 9 (position 33467496)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32623442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGTCAGCTGAGTGCCAGTTATTAGACCCGGAGCACCAGAATGTGTG[C/A]CAGGACATGAAGATGCCCCTGTCTCATTATTTTATCAGTGCCTCCTACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097475 Nonsense 539 1137 3 8
ENSDART00000136894   None 464 None 6
ENSDART00000144608 Nonsense 547 578 3 3
Genomic Location (Zv9):
Chromosome 9 (position 33467959)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32623905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCCTGTTAGTTTGGGAGGTCGTGCGACTACCTTGCCATCTCCAGAA[C/T]AACTGAAGGGCAAGGTGCTTCTTGTTGGAAAGAAGCTTCCCCCAGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2490
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097475 Essential Splice Site 1045 1137 6 8
ENSDART00000136894 Essential Splice Site 392 464 4 6
ENSDART00000144608   None 578 None 3
Genomic Location (Zv9):
Chromosome 9 (position 33484397)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32640343
KASP Assay ID:
554-2762.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAATGCAGATGGAGTGCAGGAGAAAATCGCTCAAGTGCAAAAAGAAG[G/A]TAAGTGGAGGAGAAGATGAGAGCAGGATGAATTTCTTCCYATCTAATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link