card9

Ensembl ID:
ENSDARG00000067672
ZFIN ID:
ZDB-GENE-060531-94
Description:
caspase recruitment domain-containing protein 9 [Source:RefSeq peptide;Acc:NP_001103755]
Human Orthologue:
CARD9
Human Description:
caspase recruitment domain family, member 9 [Source:HGNC Symbol;Acc:16391]
Mouse Orthologue:
Card9
Mouse Description:
caspase recruitment domain family, member 9 Gene [Source:MGI Symbol;Acc:MGI:2685628]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11441 Nonsense Available for shipment Available now
sa3567 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097471 Nonsense 39 534 1 12
Genomic Location:
Chromosome 5 (position 52852066)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCGAATGCTTCTCATCAAGACCATTGAGCCCTCAAGGATAACACCTTA[T/A]CTGAGACAGTGCAAGGTGCTGAGCAGCGAGGATGAGGAGCAGATCTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097471 Essential Splice Site 372 534 6 12
Genomic Location:
Chromosome 5 (position 52846144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGACATTCTGAAACAGCTGGAAGAGGTGATCAAAGAAAGAGACAAGG[T/C]ATAAACCCTYATCAGAGCAATACAATACAGTCATGTTCTGTATAGTTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ankylosing spondylitis: Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility. (View Study)
  • Crohn's disease: A genome-wide association study on a southern European population identifies a new Crohn's disease susceptibility locus at RBX1-EP300. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Monocyte chemoattractant protein-1 : Genome-wide association replicates the association of Duffy antigen receptor for chemokines (DARC) polymorphisms with serum monocyte chemoattractant protein-1 (MCP-1) levels in Hispanic children. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Ulcerative colitis: Genome-wide association identifies multiple ulcerative colitis susceptibility loci. (View Study)
  • Ulcerative colitis: Genome-wide association study of ulcerative colitis identifies three new susceptibility loci, including the HNF4A region. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iehhitqa