pomt1

Ensembl ID:
ENSDARG00000067670
ZFIN ID:
ZDB-GENE-060929-966
Description:
protein O-mannosyl-transferase 1 [Source:RefSeq peptide;Acc:NP_001041532]
Human Orthologue:
POMT1
Human Description:
protein-O-mannosyltransferase 1 [Source:HGNC Symbol;Acc:9202]
Mouse Orthologue:
Pomt1
Mouse Description:
protein-O-mannosyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2138994]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33711 Nonsense Mutation detected in F1 DNA During 2017
sa14667 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092002 Nonsense 325 720 11 20
Genomic Location (Zv9):
Chromosome 5 (position 52806859)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50474055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATCCAAAATAAGCACATCTTCATGCTGTTTATTAATGTTTAAAGGTA[T/A]GAAAATGGCCGTGGAAGCTCCCACCAGCAGCAGGTGACCTGCTATCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092002 Nonsense 637 720 19 20
Genomic Location (Zv9):
Chromosome 5 (position 52813156)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50480352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTGAATTACCTGCCATTCTTCCTAATGGAGAAGACTCTCTTTCTATA[T/A]CACTATCTCCCAGCACTSACCTTCAAGATCTTGCAAATACCTATAGTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link