si:ch211-142p3.1

Ensembl ID:
ENSDARG00000067634
ZFIN ID:
ZDB-GENE-070705-36
Description:
Novel protein similar to vertebrate Rho guanine nucleotide exchange factor (GEF) 12 (ARHGEF12) [Sour
Human Orthologue:
ARHGEF12
Human Description:
Rho guanine nucleotide exchange factor (GEF) 12 [Source:HGNC Symbol;Acc:14193]
Mouse Orthologue:
Arhgef12
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 12 Gene [Source:MGI Symbol;Acc:MGI:1916882]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25313 Nonsense Mutation detected in F1 DNA During 2017
sa40576 Nonsense Mutation detected in F1 DNA During 2017
sa17710 Nonsense Available for shipment Available now
sa20550 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087610 Nonsense 657 1336 19 35
ENSDART00000144670   None 248 None 8
Genomic Location (Zv9):
Chromosome 5 (position 60191163)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58052781
KASP Assay ID:
554-7853.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGTGAAGATGATCAGTGTGTTGAAGCCGAACTCGAGCCTCCAAACT[G/A]GCAGACACTAGTGAGCAGAGACGTCCTGTCCACACTCACGCCTCAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087610 Nonsense 855 1336 24 35
ENSDART00000144670   None 248 None 8
Genomic Location (Zv9):
Chromosome 5 (position 60186250)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58047868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGACTCTGAGGAGAGAAGTAAAGTGAAACGGGCTGGCGAATGCTG[T/A]AGAAAGATCCTCACTCACGTCAACCAGGAGGTGAAGGAAGCGGAAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087610 Nonsense 947 1336 27 35
ENSDART00000144670   None 248 None 8
Genomic Location (Zv9):
Chromosome 5 (position 60181911)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58043529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGAGGATATATTGGTGCTACTTCAAAGGCAGGATGAGAAGCTGATCT[T/G]AAAATGCCACAGTAAGAATCTGGCRGGCACCGCTGAGACCAAACACAWCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087610 Essential Splice Site 981 1336 27 35
ENSDART00000144670   None 248 None 8
Genomic Location (Zv9):
Chromosome 5 (position 60181808)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58043426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCCATCATCAAGCTCAGCACTGTGATGGTGCGCTCCGTTGCCACCGG[T/C]ACGATAACAGAGATGTTAAAATCTGACAATGTGAATGCTTAAAGCTGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link