ywhag1

Ensembl ID:
ENSDARG00000067626
ZFIN ID:
ZDB-GENE-011115-1
Description:
14-3-3 protein gamma-1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PC29]
Human Orthologue:
YWHAG
Human Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide [Source:HG
Mouse Orthologue:
Ywhag
Mouse Description:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide Gene [Sour

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2193 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2193
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080486 Nonsense 5 247 1 2
Genomic Location:
Chromosome 5 (position 3518625)
KASP Assay ID:
554-2456.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AANNNNGAGAGCACTCATACWGCACCCCAAARYTGAACATGGTCGACCGC[G/T]AGCAGCTGGTGCAGAAAGCCAGACTGGCCGAGCAGGCGGAGAGATATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jbns3hzq