LOC100333286

Ensembl ID:
ENSDARG00000067617
Mouse Orthologues:
Gm4951, Ifi47, Irgc1
Mouse Descriptions:
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
predicted gene 4951 Gene [Source:MGI Symbol;Acc:MGI:3644953]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15128 Nonsense Available for shipment Available now
sa6433 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097365 Nonsense 53 533 2 2
Genomic Location:
Chromosome 16 (position 28208927)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCAGCCAATCTTCTGGGTCATCAAACACATYACAGACATTCRGCAAC[A/T]AAAACAGTAAAGAAACTACACYTCCAAAATCCTCWCAAAYATCTACTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097365 Nonsense 102 533 2 2
Genomic Location:
Chromosome 16 (position 28208778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATCAGTCCAAGAAAGTTGCTGTTAAAACTGCAATTAGCTGATAAATA[T/A]GCACAAACTGACCATAATGAGAAGCTCAGTGAAAATGACCTTAAAGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/repqhrvw