rsph4a

Ensembl ID:
ENSDARG00000067606
ZFIN ID:
ZDB-GENE-030131-7437
Description:
Novel protein similar to vertebrate radial spokehead-like 3 (RSHL3) [Source:UniProtKB/TrEMBL;Acc:A2C
Human Orthologues:
RSPH4A, RSPH6A
Human Descriptions:
radial spoke head 4 homolog A (Chlamydomonas) [Source:HGNC Symbol;Acc:21558]
radial spoke head 6 homolog A (Chlamydomonas) [Source:HGNC Symbol;Acc:14241]
Mouse Orthologues:
Rsph4a, Rsph6a
Mouse Descriptions:
radial spoke head 4 homolog A (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:3027894]
radial spoke head 6 homolog A (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1927643]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15262 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097340 Essential Splice Site 212 524 3 7
Genomic Location:
Chromosome 5 (position 64985166)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGAAGAGCTGCAGGAGGGCAAGGAYGAAGCAGAGCTTGTGGAGGCTG[T/A]AAGTCATAAATTAGCATCCTATGTAAATGAATCTGCTRTYAATATTTTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e4c91kq0