arfgap2

Ensembl ID:
ENSDARG00000067601
ZFIN ID:
ZDB-GENE-051120-177
Description:
ADP-ribosylation factor GTPase-activating protein 2 [Source:RefSeq peptide;Acc:NP_001032507]
Human Orthologue:
ARFGAP2
Human Description:
ADP-ribosylation factor GTPase activating protein 2 [Source:HGNC Symbol;Acc:13504]
Mouse Orthologue:
Arfgap2
Mouse Description:
ADP-ribosylation factor GTPase activating protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924288]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13828 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097328 Nonsense 415 536 12 16

The following transcripts of ENSDARG00000067601 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 43287033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGAGCCTAAAGACAGCGAGGTCACCATCTCAAGCATCCAGCCAATC[G/T]GAGAAAGGTAACGTCCTCATCYGGCAGTCAGTGGGTTTGGYTTTGATTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jt8vspxr