SCO1

Ensembl ID:
ENSDARG00000067593
Description:
SCO cytochrome oxidase deficient homolog 1 (yeast) [Source:HGNC Symbol;Acc:10603]
Human Orthologue:
SCO1
Human Description:
SCO cytochrome oxidase deficient homolog 1 (yeast) [Source:HGNC Symbol;Acc:10603]
Mouse Orthologue:
Sco1
Mouse Description:
SCO cytochrome oxidase deficient homolog 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:106362]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8760 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097312 Nonsense 294 318 7 7
Genomic Location (Zv9):
Chromosome 3 (position 62865780)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61966885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATCATCATGTACCTGGTGGGACCCGACGGCCAGTTTCTGGAGTATTA[C/A]GGACAGAACAAGAAGTCCTCGGAGAKCGCCTCATCCATCGCATCCTACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Malaria: Genome-wide and fine-resolution association analysis of malaria in West Africa. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link