ctsbb

Ensembl ID:
ENSDARG00000067570
ZFIN ID:
ZDB-GENE-070323-1
Description:
capthepsin B, b [Source:RefSeq peptide;Acc:NP_001103948]
Human Orthologue:
CTSB
Human Description:
cathepsin B [Source:HGNC Symbol;Acc:2527]
Mouse Orthologue:
Ctsb
Mouse Description:
cathepsin B Gene [Source:MGI Symbol;Acc:MGI:88561]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43551 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097263 Essential Splice Site 143 326 5 11
ENSDART00000143467   None 109 None 4
Genomic Location (Zv9):
Chromosome 20 (position 53529602)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53090084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTCAGCTGAAGATCTGCTGTCCTGCTGTGATCAGTGTGGATTCGGG[T/C]GCGTCTGATCAAGAACTGTACTAAAGTACTGGAATTAACTTTTGGTGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link