FNDC3A

Ensembl ID:
ENSDARG00000067569
Description:
fibronectin type III domain containing 3A [Source:HGNC Symbol;Acc:20296]
Human Orthologue:
FNDC3A
Human Description:
fibronectin type III domain containing 3A [Source:HGNC Symbol;Acc:20296]
Mouse Orthologue:
Fndc3a
Mouse Description:
fibronectin type III domain containing 3A Gene [Source:MGI Symbol;Acc:MGI:1196463]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22578 Nonsense Mutation detected in F1 DNA During 2014
sa22577 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097261 Nonsense 131 1166 3 29
Genomic Location:
Chromosome 15 (position 3112827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTCAACACGGCCGGGCGGCGTTCGCTCATCGAGATGAAAGGACTTGT[A/T]AAACCTACGAGCGTCTGCAAAAGAAGCTGAAGGATAAGCAGGGGGTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097261 Nonsense 396 1166 11 29
Genomic Location:
Chromosome 15 (position 3097661)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGGAAGGGAACGGATGCTACGTTTGTCCAGTGTTACTACGGCCCATA[T/G]AAGCAGTACAGACTCACCAAACTCTCCACAGCTTCCAGATATTCCTTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/evmlq3px