kiss1rb

Ensembl ID:
ENSDARG00000067563
ZFIN ID:
ZDB-GENE-060526-54
Description:
KISS1 receptor b [Source:RefSeq peptide;Acc:NP_001104001]
Human Orthologue:
KISS1R
Human Description:
KISS1 receptor [Source:HGNC Symbol;Acc:4510]
Mouse Orthologue:
Kiss1r
Mouse Description:
KISS1 receptor Gene [Source:MGI Symbol;Acc:MGI:2148793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40608 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097250 Nonsense 188 364 4 5
ENSDART00000136065 Nonsense 177 349 4 5
Genomic Location (Zv9):
Chromosome 5 (position 72410877)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68772209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTCTCAGTGCCGATTGCTCTGTATCAGCACACTGAGTCTTCATACTG[G/A]TTCGGCCCACAGACGTACTGCACTGAGACCTTTCCTTCGGTCATTCATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link