A5WUZ9_DANRE

Ensembl ID:
ENSDARG00000067549
Description:
Novel protein similar to vertebrate ADAM metallopeptidase with thrombospondin type 1 motif, 7 (ADAMT
Human Orthologue:
ADAMTS12
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 12 [Source:HGNC Symbol;Acc:14605]
Mouse Orthologue:
Adamts12
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12 Gene

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3543 Nonsense Mutation detected in F1 DNA During 2014
sa15083 Essential Splice Site Available for shipment Available now
sa25290 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10586 Essential Splice Site Available for shipment Available now
sa1731 Nonsense Available for shipment Available now
sa20346 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Nonsense 94 1499 3 26
Genomic Location:
Chromosome 5 (position 9301080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGGCGTCAGAAGAGAGACCTGAATTCAGCAGAGAGGCGAGTGTATTA[C/A]AAACTCAACTACAGAGGTCGAGAGCTGACTCTTAATCTGACCACCAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Essential Splice Site 543 1499 11 26
Genomic Location:
Chromosome 5 (position 9268115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTAAACKAGACTCACCGATYGACGGAACCAGGTGTGGACCTGAAAAG[G/A]TAGGAGAGATACACAATYARAAAGAAGCACATAGTATTTGTTCTGTTMTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Essential Splice Site 543 1499 11 26
Genomic Location:
Chromosome 5 (position 9268114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAAACTAGACTCACCGATCGACGGAACCAGGTGTGGACCTGAAAAGG[T/A]AGGAGAGATACACAATTAGAAAGAAGCACATAGTATTTGTTCTGTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Essential Splice Site 649 1499 13 26
Genomic Location:
Chromosome 5 (position 9264315)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCGTATCACAATGAACTCTACCAGTGGATTCCTGTTTCAAGCCCTTG[T/A]AAGATCWCTTTGCATCAATATTCATTCATTCATTNNNNNNNNNNNNNNNNCATYNNNNTTATTTCGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Nonsense 797 1499 16 26
Genomic Location:
Chromosome 5 (position 9254807)
KASP Assay ID:
554-1676.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATGGAGAGTAYGAGGCTGGTGGCACAAAGTTTAACTACGAGCGCAGC[G/T]GAAATATAGAGAATCTCACCTCAGCGGGACCAACAACTGAACYTGTCATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa20346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097221 Nonsense 995 1499 20 26
Genomic Location:
Chromosome 5 (position 9247786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTTGTGATGGAGGAATAAAGTCGCGAATGGTCAAGTGTGTGGCAAAA[C/T]AACCCAGCCGGTGCAACCCTGCCACTCGACCCCGCTCCACAATCCTCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)
  • Stroke (pediatric): A genome-wide association study identifies a gene network of ADAMTS genes in the predisposition to pediatric stroke. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7iar3drr