fgf10b

Ensembl ID:
ENSDARG00000067548
ZFIN ID:
ZDB-GENE-060828-1
Description:
fibroblast growth factor 10b [Source:RefSeq peptide;Acc:NP_001039323]
Human Orthologue:
FGF10
Human Description:
fibroblast growth factor 10 [Source:HGNC Symbol;Acc:3666]
Mouse Orthologue:
Fgf10
Mouse Description:
fibroblast growth factor 10 Gene [Source:MGI Symbol;Acc:MGI:1099809]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20345 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097220 Essential Splice Site 125 187 3 3
Genomic Location:
Chromosome 5 (position 9163111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTATGAGCTGGCACAGAAGCAAATGTAACACTCTTTTTATGCATTTC[A/G]GAGAAACTACGGCACAAATTGCCGCCTGAAGGAGCGCATCGAGGAGAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/glqg3att