pcsk5a

Ensembl ID:
ENSDARG00000067537
ZFIN ID:
ZDB-GENE-060531-130
Description:
Novel protein similar to vertebrate furin (Paired basic amino acid cleaving enzyme) (FURIN) [Source:
Human Orthologue:
PCSK5
Human Description:
proprotein convertase subtilisin/kexin type 5 [Source:HGNC Symbol;Acc:8747]
Mouse Orthologue:
Pcsk5
Mouse Description:
proprotein convertase subtilisin/kexin type 5 Gene [Source:MGI Symbol;Acc:MGI:97515]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8843 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20536 Essential Splice Site Available for shipment Available now
sa33720 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38507 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14669 Essential Splice Site Available for shipment Available now
sa9667 Nonsense Available for shipment Available now
sa397 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085314 Essential Splice Site 404 1821 11 37
ENSDART00000131060 Essential Splice Site 425 1093 11 27
Genomic Location (Zv9):
Chromosome 5 (position 55870669)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54655339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATAAAGTGTAMAGTGTGCACTACACTGTAWTTTCAKTGGCTGTTTTGC[A/T]GTTAGTCACCTTTATGGRTTTGGGTTGCTGAATGCTGAGGCCATGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085314 Essential Splice Site 404 1821 11 37
ENSDART00000131060 Essential Splice Site 425 1093 11 27
Genomic Location (Zv9):
Chromosome 5 (position 55870670)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54655340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAAGTGTACAGTGTGCACTACACTGTATTTTCATTGGCTGTTTTGCA[G/A]TTAGTCACCTTTATGGGTTTGGGTTGCTGAATGCTGAGGCCATGGTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085314 Essential Splice Site 797 1821 20 37
ENSDART00000131060 Essential Splice Site 818 1093 20 27
Genomic Location (Zv9):
Chromosome 5 (position 55877611)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54662281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTATCATCATCCTGTCACTTTTTTTTTCAAGATTGTCCATTTGTGC[A/T]GGTGTGATGCAAGCTGTCTGGCTTGTGTCGGGCCAACTAAAACAAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085314 Essential Splice Site 916 1821 22 37
ENSDART00000131060 Essential Splice Site 937 1093 22 27
Genomic Location (Zv9):
Chromosome 5 (position 55882411)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54667081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAGTGTGTTGATGCTGGTCCTTCTAACTGTACCAGCTGTGATACAGG[T/G]CAGTATGCATGTTTTCCCAGTAAATAAGTAAGCCCTAATGTGTGTGACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085314 Essential Splice Site 1020 1821 25 37
ENSDART00000131060 Essential Splice Site 1041 1093 25 27
Genomic Location (Zv9):
Chromosome 5 (position 55908146)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54692816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACAGATAATCCAAAACACTGTCTATCCTGCATTAATGGATATTACAGG[T/C]AAGAATATTTGAATGTCATAACAAAACTATCCAATTATACAAATTTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085314 Nonsense 1132 1821 27 37
ENSDART00000131060   None 1093 None 27
ENSDART00000085314 Nonsense 1132 1821 27 37
ENSDART00000131060   None 1093 None 27
Genomic Location (Zv9):
Chromosome 5 (position 55911068)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54695738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAATGGAGCTTGTGTATCTGAACAGGATGTTTGCCCTGCACAGATGTA[T/A]CTCACWGGTAAGATATGGWGTCAATCTAGGGTCATAATAAGAGAACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085314 Nonsense 1132 1821 27 37
ENSDART00000131060   None 1093 None 27
ENSDART00000085314 Nonsense 1132 1821 27 37
ENSDART00000131060   None 1093 None 27
Genomic Location (Zv9):
Chromosome 5 (position 55911068)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54695738
KASP Assay ID:
554-0259.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAATGGAGCTTGTGTATCTGAACAGGATGTTTGCCCTGCACAGATGTA[T/A]CTCACAGGTAAGATATGGAGTCAATCTAGGGTCATAATAAGAGAACAAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link