CCDC15

Ensembl ID:
ENSDARG00000067517
Description:
coiled-coil domain containing 15 [Source:HGNC Symbol;Acc:25798]
Human Orthologue:
CCDC15
Human Description:
coiled-coil domain containing 15 [Source:HGNC Symbol;Acc:25798]
Mouse Orthologue:
Ccdc15
Mouse Description:
coiled-coil domain containing 15 Gene [Source:MGI Symbol;Acc:MGI:2444488]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10073 Essential Splice Site Available for shipment Available now
sa517 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097160 Essential Splice Site 182 459 5 14
Genomic Location:
Chromosome 5 (position 59896042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATCGCAGCTACCTGGTGGGAGATGGAAAATATCTCYTGCTAGAAAT[G/A]TGAGTCATGCAWGATGCATTTGGGTCATTTTCAAGACSTGAACAGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097160 Essential Splice Site 286 459 10 14
Genomic Location:
Chromosome 5 (position 59905587)
KASP Assay ID:
554-0347.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTTACCAAAACTATTGCCTTTTTCAATCATTAAGCATTTTGTTTC[A/T]GAGGCAGTCTCAGTTCCTTATGTATCGACGACACTTCATGGACATCGAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uduerr1n