CCDC15

Ensembl ID:
ENSDARG00000067517
Description:
coiled-coil domain containing 15 [Source:HGNC Symbol;Acc:25798]
Human Orthologue:
CCDC15
Human Description:
coiled-coil domain containing 15 [Source:HGNC Symbol;Acc:25798]
Mouse Orthologue:
Ccdc15
Mouse Description:
coiled-coil domain containing 15 Gene [Source:MGI Symbol;Acc:MGI:2444488]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10073 Essential Splice Site Available for shipment Available now
sa517 Essential Splice Site Available for shipment Available now
sa40572 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097160 Essential Splice Site 182 459 5 14
Genomic Location:
Chromosome 5 (position 59896042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTATCGCAGCTACCTGGTGGGAGATGGAAAATATCTCYTGCTAGAAAT[G/A]TGAGTCATGCAWGATGCATTTGGGTCATTTTCAAGACSTGAACAGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097160 Essential Splice Site 286 459 10 14
Genomic Location:
Chromosome 5 (position 59905587)
KASP Assay ID:
554-0347.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTTACCAAAACTATTGCCTTTTTCAATCATTAAGCATTTTGTTTC[A/T]GAGGCAGTCTCAGTTCCTTATGTATCGACGACACTTCATGGACATCGAGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097160 Nonsense 295 459 10 14
Genomic Location:
Chromosome 5 (position 59905616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCATTAAGCATTTTGTTTCAGAGGCAGTCTCAGTTCCTTATGTATCGA[C/T]GACACTTCATGGACATCGAGCGAGAGCAAGTGAAGGAGCACAAAAGGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link