si:ch211-87l8.1

Ensembl ID:
ENSDARG00000067509
ZFIN ID:
ZDB-GENE-081031-75
Description:
Novel protein similar to vertebrate solute carrier family 24 (Sodium/potassium/calcium exchanger), m
Human Orthologue:
SLC24A4
Human Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 [Source:HGNC Symbol;Acc:1097
Mouse Orthologue:
Slc24a4
Mouse Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 Gene [Source:MGI Symbol;Acc:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37169 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10429 Essential Splice Site Available for shipment Available now
sa37170 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031139 Essential Splice Site 213 636 5 17
ENSDART00000145132 Essential Splice Site 80 165 3 7
ENSDART00000148149   None 203 None 5
Genomic Location (Zv9):
Chromosome 20 (position 50475792)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50360533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATGGCTGCGGGAAGCTCAGCGCCCGAACTCTTCGCTTCGGTTATAGG[T/A]AAATGCGTCCCTCAGTCACAATCATTTTGCACAAAGAAACAATCCCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031139 Essential Splice Site 272 636 7 17
ENSDART00000145132 Essential Splice Site 139 165 5 7
ENSDART00000148149   None 203 None 5
Genomic Location (Zv9):
Chromosome 20 (position 50477906)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50362647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCCGTGACTYTTTCTTCTACATATTGTCTGTAGTCGCCCTGATTGTG[G/A]TGAGTCTTAAATMAAACACGCTAACAYCTYTCTGTAATGAGTTTCCCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031139 Essential Splice Site 490 636 14 17
ENSDART00000145132   None 165 None 7
ENSDART00000148149 Essential Splice Site 57 203 2 5
Genomic Location (Zv9):
Chromosome 20 (position 50501077)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 50385818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTATATCAACATACAGATGACACTTGACCAGTTTCCATTACTTCTTCC[A/G]GGTGACAATTATTGGATATACGCTGGGCATTCCTGATGTCATCATGGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link