pde11a

Ensembl ID:
ENSDARG00000063732
ZFIN ID:
ZDB-GENE-070912-207
Description:
Novel protein similar to H.sapiens PDE11A, phosphodiesterase 11A (PDE11A) [Source:UniProtKB/TrEMBL;A
Human Orthologue:
PDE11A
Human Description:
phosphodiesterase 11A [Source:HGNC Symbol;Acc:8773]
Mouse Orthologue:
Pde11a
Mouse Description:
phosphodiesterase 11A Gene [Source:MGI Symbol;Acc:MGI:3036251]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34541 Essential Splice Site Available for shipment Available now
sa10249 Nonsense Available for shipment Available now
sa31695 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093427   None 878 None 24
ENSDART00000137230 Essential Splice Site 335 865 4 19
Genomic Location (Zv9):
Chromosome 9 (position 1519653)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1528706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTA[G/T]GCTCTACTGGAGGTGGTGAATGATCTGTTCGAGGAGCAGACGGATCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093427 Nonsense 436 878 8 24
ENSDART00000137230 Nonsense 439 865 6 19
Genomic Location (Zv9):
Chromosome 9 (position 1525205)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1534258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGCTGGTGGCCTCCACTGGACTTCCTGTGAACATCAGCGACGCCTA[T/A]CAAGACCCTCGATTCGACGCTGAGGTAAARGCTCCAGCCAATCAGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093427 Essential Splice Site 444 878 8 24
ENSDART00000137230 Essential Splice Site 447 865 6 19
Genomic Location (Zv9):
Chromosome 9 (position 1525231)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1534284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGAACATCAGCGACGCCTATCAAGACCCTCGATTCGACGCTGAGG[T/C]AAAGGCTCCAGCCAATCAGTGAAAAGCTTTGGGTGATGCATTAAATCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link