osbpl6

Ensembl ID:
ENSDARG00000063730
ZFIN ID:
ZDB-GENE-070912-206
Description:
oxysterol-binding protein-related protein 6 [Source:RefSeq peptide;Acc:NP_001120877]
Human Orthologue:
OSBPL6
Human Description:
oxysterol binding protein-like 6 [Source:HGNC Symbol;Acc:16388]
Mouse Orthologue:
Osbpl6
Mouse Description:
oxysterol binding protein-like 6 Gene [Source:MGI Symbol;Acc:MGI:2139014]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21414 Essential Splice Site Available for shipment Available now
sa41333 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093412 Essential Splice Site 108 903 4 23
ENSDART00000124777 Essential Splice Site 108 910 4 23
Genomic Location (Zv9):
Chromosome 9 (position 1418008)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1427061
KASP Assay ID:
2260-1355.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCGTCCTGGATAACGGCATCCTGAAGTACTCCAAATCTCCAGTCGAT[G/A]TGAGTGAAAATGTGTAGTTGTCCACAAACATATTCAGCTGTTTGTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093412 Nonsense 599 903 15 23
ENSDART00000124777 Nonsense 598 910 15 23
Genomic Location (Zv9):
Chromosome 9 (position 1393393)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1402446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTACACCGAGCTCCTGGATAAAGCAGCTCAGACTGACGACCCCTA[C/A]GAGCGCATGGTACGGTCGAGCTCTTAAAGGCACGGTGCACCCTGAAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link