cdk12

Ensembl ID:
ENSDARG00000063726
ZFIN ID:
ZDB-GENE-081104-294
Description:
Novel protein similar to H.sapiens CRKRS, Cdc2-related kinase, arginine/serine-rich (CRKRS) [Source:
Human Orthologue:
CDK12
Human Description:
cyclin-dependent kinase 12 [Source:HGNC Symbol;Acc:24224]
Mouse Orthologue:
Cdk12
Mouse Description:
cyclin-dependent kinase 12 Gene [Source:MGI Symbol;Acc:MGI:1098802]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1307 Nonsense Available for shipment Available now
sa29141 Nonsense Mutation detected in F1 DNA During 2015
sa23419 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa1307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093402 Nonsense 250 1293 1 14
ENSDART00000143222 Nonsense 102 688 1 7
Genomic Location:
Chromosome 19 (position 5482053)
KASP Assay ID:
554-1222.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYGTGCGTTCATCCAAATCTCGCAAAGAAAAGAGAAGGAACGAGGAGTA[T/A]GAGGAGGMCCGGAGCCATCGAAAGGCCGCAAAGAGTCGCAAGTCTAGCCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa29141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093402 Nonsense 728 1293 5 14
ENSDART00000143222 Nonsense 580 688 5 7
Genomic Location:
Chromosome 19 (position 5502949)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGAGGGTTTCCCCATCACCGCCATCAGGGAAATCAAGATCCTGAGG[C/T]AACTCAACCATCGCAGCGTGGTCAACATGAAAGAGATCGTCACTGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093402 Essential Splice Site 897 1293 10 14
ENSDART00000143222   None 688 None 7
Genomic Location:
Chromosome 19 (position 5509766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGGGCTTCAGTTGAAATGCTGTTTGTCTTCTTTTCTCCCCCGATCA[G/A]TCGTTTGTGTGGTAGTCCATGTCCTGCTGCTTGGCCAGATGTAATCCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1eipjy3o