cdk12

Ensembl ID:
ENSDARG00000063726
ZFIN ID:
ZDB-GENE-081104-294
Description:
Novel protein similar to H.sapiens CRKRS, Cdc2-related kinase, arginine/serine-rich (CRKRS) [Source:
Human Orthologue:
CDK12
Human Description:
cyclin-dependent kinase 12 [Source:HGNC Symbol;Acc:24224]
Mouse Orthologue:
Cdk12
Mouse Description:
cyclin-dependent kinase 12 Gene [Source:MGI Symbol;Acc:MGI:1098802]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1307 Nonsense Available for shipment Available now
sa23419 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093402 Nonsense 250 1293 1 14
ENSDART00000143222 Nonsense 102 688 1 7
Genomic Location:
Chromosome 19 (position 5482053)
KASP Assay ID:
554-1222.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYGTGCGTTCATCCAAATCTCGCAAAGAAAAGAGAAGGAACGAGGAGTA[T/A]GAGGAGGMCCGGAGCCATCGAAAGGCCGCAAAGAGTCGCAAGTCTAGCCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093402 Essential Splice Site 897 1293 10 14
ENSDART00000143222 None None 688 None 7
Genomic Location:
Chromosome 19 (position 5509766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGGGCTTCAGTTGAAATGCTGTTTGTCTTCTTTTCTCCCCCGATCA[G/A]TCGTTTGTGTGGTAGTCCATGTCCTGCTGCTTGGCCAGATGTAATCCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1eipjy3o