ENSDARG00000063721

Ensembl ID:
ENSDARG00000063721
Human Orthologues:
CDK16, CDK17, CDK18
Human Descriptions:
cyclin-dependent kinase 16 [Source:HGNC Symbol;Acc:8749]
cyclin-dependent kinase 17 [Source:HGNC Symbol;Acc:8750]
cyclin-dependent kinase 18 [Source:HGNC Symbol;Acc:8751]
Mouse Orthologues:
Cdk16, Cdk17, Cdk18
Mouse Descriptions:
cyclin-dependent kinase 16 Gene [Source:MGI Symbol;Acc:MGI:97516]
cyclin-dependent kinase 17 Gene [Source:MGI Symbol;Acc:MGI:97517]
cyclin-dependent kinase 18 Gene [Source:MGI Symbol;Acc:MGI:97518]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18935 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11008 Essential Splice Site Available for shipment Available now
sa38718 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103073 Essential Splice Site 80 382 2 11
ENSDART00000103073 Essential Splice Site 80 382 2 11
Genomic Location:
Chromosome 9 (position 341632)
KASP Assay ID:
2260-1320.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTACGAGTGCGCATGCGTAACCTACATCAGCGCATCTCCAATGAGG[T/G]AAATCACACTGTTGTACTCACAGAGACGCACACAGACACATACCAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103073 Essential Splice Site 80 382 2 11
ENSDART00000103073 Essential Splice Site 80 382 2 11
Genomic Location:
Chromosome 9 (position 341632)
KASP Assay ID:
2260-1320.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTACGAGTGCGCATGCGTAACCTACATCAGCGCATCTCCAATGAGG[T/G]AAATCACACTGTTKTACTCACASAGACGCACACAGACACATRCCAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103073 Nonsense 277 382 9 11
Genomic Location:
Chromosome 9 (position 348649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCAGAGTGTTGGTGTTCATGTAAACACACTGATTGTGCAGGTCTCGCC[C/T]GAGCCAAGTCGGTCCCCACAAAGACGTTCTCTAATGAGGTGGTGACGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link