ENSDARG00000063721

Ensembl ID:
ENSDARG00000063721
Human Orthologues:
CDK16, CDK17, CDK18
Human Descriptions:
cyclin-dependent kinase 16 [Source:HGNC Symbol;Acc:8749]
cyclin-dependent kinase 17 [Source:HGNC Symbol;Acc:8750]
cyclin-dependent kinase 18 [Source:HGNC Symbol;Acc:8751]
Mouse Orthologues:
Cdk16, Cdk17, Cdk18
Mouse Descriptions:
cyclin-dependent kinase 16 Gene [Source:MGI Symbol;Acc:MGI:97516]
cyclin-dependent kinase 17 Gene [Source:MGI Symbol;Acc:MGI:97517]
cyclin-dependent kinase 18 Gene [Source:MGI Symbol;Acc:MGI:97518]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18935 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11008 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103073 Essential Splice Site 80 382 2 11
ENSDART00000103073 Essential Splice Site 80 382 2 11
Genomic Location:
Chromosome 9 (position 341632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTACGAGTGCGCATGCGTAACCTACATCAGCGCATCTCCAATGAGG[T/G]AAATCACACTGTTGTACTCACAGAGACGCACACAGACACATACCAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103073 Essential Splice Site 80 382 2 11
ENSDART00000103073 Essential Splice Site 80 382 2 11
Genomic Location:
Chromosome 9 (position 341632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTACGAGTGCGCATGCGTAACCTACATCAGCGCATCTCCAATGAGG[T/G]AAATCACACTGTTKTACTCACASAGACGCACACAGACACATRCCAGATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zgshzk4m