ENSDARG00000063715

Ensembl ID:
ENSDARG00000063715
Human Orthologue:
HECW1
Human Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:22195]
Mouse Orthologue:
Hecw1
Mouse Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 Gene [Source:MGI Symbol;Acc:MGI:2444

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24425 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4266 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093371 Essential Splice Site 769 923 9 13
Genomic Location:
Chromosome 24 (position 931168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGAGGTGGATGAGTCGCCTGTGGCGGGACCTAGTGTTCGGCCAACAGG[T/C]GAGGAGGCTTTTCTGAATTGTGCATTGCTGATTGGATAAAAATGGGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093371 Essential Splice Site 803 923 11 13
Genomic Location:
Chromosome 24 (position 934067)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCTCCACAGRAGGACAGTGGATGATGTGTGTGTGTGTTTGTGCACA[G/T]ATTGGGAGGCGCGTGTGGACAGTCACGGTCGTGTTTTTTACGTGGATCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/08rukyau