ENSDARG00000063715

Ensembl ID:
ENSDARG00000063715
Human Orthologue:
HECW1
Human Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:22195]
Mouse Orthologue:
Hecw1
Mouse Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 Gene [Source:MGI Symbol;Acc:MGI:2444

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24425 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093371 Essential Splice Site 769 923 9 13
Genomic Location (Zv9):
Chromosome 24 (position 931168)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 884562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGAGGTGGATGAGTCGCCTGTGGCGGGACCTAGTGTTCGGCCAACAGG[T/C]GAGGAGGCTTTTCTGAATTGTGCATTGCTGATTGGATAAAAATGGGATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link