trim3a

Ensembl ID:
ENSDARG00000063711
ZFIN ID:
ZDB-GENE-080522-4
Human Orthologue:
TRIM3
Human Description:
tripartite motif-containing 3 [Source:HGNC Symbol;Acc:10064]
Mouse Orthologue:
Trim3
Mouse Description:
tripartite motif-containing 3 Gene [Source:MGI Symbol;Acc:MGI:1860040]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2787 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093367 Essential Splice Site 180 774 3 13
Genomic Location:
Chromosome 15 (position 31578221)
KASP Assay ID:
554-2593.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAACACAAAGCGGCGCTGAAGAACCAGCTGGATGCTATTCGAAACAGG[T/A]TCACACTGCCAAAAATAATACYGAGCTCACTGATAATCTGAGCCCAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yq2w6zn9