tbk1

Ensembl ID:
ENSDARG00000063708
ZFIN IDs:
ZDB-GENE-060512-359, ZDB-GENE-060512-359
Description:
serine/threonine-protein kinase TBK1 [Source:RefSeq peptide;Acc:NP_001038213]
Human Orthologue:
TBK1
Human Description:
TANK-binding kinase 1 [Source:HGNC Symbol;Acc:11584]
Mouse Orthologue:
Tbk1
Mouse Description:
TANK-binding kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1929658]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29267 Essential Splice Site, Missense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa29267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075762 Essential Splice Site 307 365 8 9
ENSDART00000093347 Missense 308 727 7 20
Genomic Location:
Chromosome 19 (position 46937986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGGGGGTTTGATCAGTTCTTCGCAGAGACCAGCGACATCTTACACC[G/T]CATCGTGGTCTACGTCTTCAGTCTGCAGCAGGCCACGCTGCACCACGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5d5oxrwl