si:ch211-266d19.3

Ensembl ID:
ENSDARG00000063701
ZFIN ID:
ZDB-GENE-030219-137
Human Orthologue:
RREB1
Human Description:
ras responsive element binding protein 1 [Source:HGNC Symbol;Acc:10449]
Mouse Orthologue:
Rreb1
Mouse Description:
ras responsive element binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443664]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24433 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093331 Essential Splice Site 242 1563 5 9
ENSDART00000144307   None 214 None 6
Genomic Location (Zv9):
Chromosome 24 (position 2394095)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2364093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAATGACTACGACACCCACATGGAAATCCATCCCGACACTACATTAAG[G/C]TACAAACAGGGTGCAAATTACAGGGGGGGTTTGGGGGGAGATTGGTCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link