FARP1 (2 of 2)

Ensembl ID:
ENSDARG00000063695
Description:
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) [Source:HGNC Symbol;Acc:
Human Orthologue:
FARP1
Human Description:
FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Farp1
Mouse Description:
FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) Gene [Source:MGI Symbol;

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44699 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093306 Nonsense 36 314 2 11
Genomic Location (Zv9):
Chromosome 9 (position 1179652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCGTGACGTTGTTCTCATCTCTGCTGTTGCTTTACTTTACAGGTCTG[G/A]CTGGATTTACTAAAGCCCATTAGAAAGCAGATCACACGTAAGACCACTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link