MON2

Ensembl ID:
ENSDARG00000063694
Description:
MON2 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29177]
Human Orthologue:
MON2
Human Description:
MON2 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29177]
Mouse Orthologue:
Mon2
Mouse Description:
MON2 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914324]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12167 Essential Splice Site Available for shipment Available now
sa37978 Nonsense Available for shipment Available now
sa37977 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093291 Essential Splice Site 330 1718 9 36
Genomic Location (Zv9):
Chromosome 25 (position 1735230)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1595567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCTCCGGGTMGTCTCCGTGCTGAWCAAACACTTCTACAGCCTCCTGG[T/A]GAGAAATGCAGCTTAACGTCAGCTTTACAAGAGTTATAYTCATWGAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093291 Nonsense 1246 1718 28 36
Genomic Location (Zv9):
Chromosome 25 (position 1711053)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1571715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCTTCACTTCCGCCACCTGGAGAGGAGCTGGACGACTCGGCCCTCTG[G/A]TGGTCAGCGTGGAACACTTGGTACCGAGTAGGAACTGAGTGCACACGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093291 Essential Splice Site 1637 1718 35 36
Genomic Location (Zv9):
Chromosome 25 (position 1696700)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1557507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTGCCTGATTCTCAGCGTTTGTCACCATTTGTCTTTTGTTTCCTCA[A/G]GGCAACAAGTGACTGAGATCATCTTTGTGTTAAAAGCCATCAGTACTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link