AXL (2 of 2)

Ensembl ID:
ENSDARG00000063691
Description:
AXL receptor tyrosine kinase [Source:HGNC Symbol;Acc:905]
Human Orthologue:
AXL
Human Description:
AXL receptor tyrosine kinase [Source:HGNC Symbol;Acc:905]
Mouse Orthologue:
Axl
Mouse Description:
AXL receptor tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:1347244]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22558 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6360 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093249 Essential Splice Site 60 304 3 9
Genomic Location:
Chromosome 15 (position 33480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGGCTTCTGCTAATGCTAATGCTAATGCTCTGCTTTACTGTGTTGC[A/C]GAAACAGGCCAGTCCAGAGGTGAGTGTTCACCATCTCCTGTTCACTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093249 Nonsense 187 304 7 9
Genomic Location:
Chromosome 15 (position 28740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNNNNNNNNNNNNNNNNNNTCAGGTGAGYTTGGCTCTGTGATGGAGGGTTCTCTCTCTCAGGAGGACT[C/A]GGTGCTGAAGGTGGCAGTAAAGACCATGAAAAGTGAGTGATGTTCATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ozd7v124