ENSDARG00000063681

Ensembl ID:
ENSDARG00000063681
Human Orthologue:
CCDC88A
Human Description:
coiled-coil domain containing 88A [Source:HGNC Symbol;Acc:25523]
Mouse Orthologue:
Ccdc88a
Mouse Description:
coiled coil domain containing 88A Gene [Source:MGI Symbol;Acc:MGI:1925177]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6279 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093278 Nonsense 249 781 6 25
ENSDART00000111198 Nonsense 370 888 8 26
Genomic Location:
Chromosome 13 (position 56245)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTTTRCATTAGCAGATGCTTCTGATGATTGAGGAGGTGTTGATTCAT[C/T]AAGACGAGGCCGTACACACATGCAGAGCTGATTATGTCTAACCTTATCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dhh5t42z