TULP3

Ensembl ID:
ENSDARG00000063672
Description:
tubby like protein 3 [Source:HGNC Symbol;Acc:12425]
Human Orthologue:
TULP3
Human Description:
tubby like protein 3 [Source:HGNC Symbol;Acc:12425]
Mouse Orthologue:
Tulp3
Mouse Description:
tubby-like protein 3 Gene [Source:MGI Symbol;Acc:MGI:1329045]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11948 Essential Splice Site Available for shipment Available now
sa18771 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3500 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093236 Essential Splice Site 19 510 1 12
ENSDART00000093236 Essential Splice Site 19 510 1 12
Genomic Location:
Chromosome 4 (position 1342138)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGGAGGACGACAGCCTGAACCTCAGGCAGCAGAAACTGGAGAAACAG[G/A]TGAGACACWTATACGCACAACAAAATATTAANGAACACGTGCAAACAGTRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093236 Essential Splice Site 19 510 1 12
ENSDART00000093236 Essential Splice Site 19 510 1 12
Genomic Location:
Chromosome 4 (position 1342138)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGAGGACGACAGCCTGAACCTCAGGCAGCAGAAACTGGAGAAACAG[G/A]TGAGACACATATACGCACAACAAAATATTAAGAACACGTGCAAACAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093236 Nonsense 316 510 8 12
Genomic Location:
Chromosome 4 (position 1333060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTCTATTGGCGGGACGCAAGAGGAAAAAGAGCAAAACATCMAACTA[T/G]CTGATCTCTGTAGACGCCACAGATCTGTCCCGCGAGGGCGAGAGCTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pfzxved2