LOC565621

Ensembl ID:
ENSDARG00000063663
Human Orthologue:
CLP1
Human Description:
CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc
Mouse Orthologue:
Clp1
Mouse Description:
CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae) Gene [Source:MGI Symbol

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4576 Nonsense Mutation detected in F1 DNA During 2014
sa6358 Essential Splice Site Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa4576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093232 Nonsense 152 443 3 6
Genomic Location:
Chromosome 14 (position 51246520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGATGTTGGAAAGTCAACRGTATGTCGGATGCTGCTGAATTATGCAGTG[C/T]GACTGGGACGCAGACCTACACTGGTGGAGCTGGACGTYGGCCAGAGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6358
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093232 Essential Splice Site 214 443 4 6
Genomic Location:
Chromosome 14 (position 51248393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTTTGGCTCCACYACTCCAGGRACAAACATCAAACTTTACAACAAGG[T/A]AATAATGACACCGRTGCACTTAAGGGAGTGTTGTTTTTACACATCAGCTT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 4
ZFS:0000036
brain
ZFA:0000008
necrotic
PATO:0000647
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
eye
ZFA:0000107
degenerate
PATO:0000639
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
trunk
ZFA:0001115
curved dorsal
PATO:0001468
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
trunk
ZFA:0001115
decreased thickness
PATO:0000592
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g35gyosb