lnpa

Ensembl ID:
ENSDARG00000063646
ZFIN ID:
ZDB-GENE-030131-4960
Description:
Protein lunapark-A [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU80]
Human Orthologue:
KIAA1715
Human Description:
KIAA1715 [Source:HGNC Symbol;Acc:21610]
Mouse Orthologue:
Lnp
Mouse Description:
limb and neural patterns Gene [Source:MGI Symbol;Acc:MGI:1918115]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34544 Nonsense Mutation detected in F1 DNA During 2017
sa27320 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093187 Nonsense 18 393 2 17
Genomic Location (Zv9):
Chromosome 9 (position 2018220)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2026463
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACACTTGTGTGTCCATTTCCAGGCTAAACCATCCACTGTAGAGGTCT[T/A]GGAGGGTCTTGATAAGGTAAAAATACTTATCTAATGATTTTCTGCTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093187 Essential Splice Site 288 393 15 17
Genomic Location (Zv9):
Chromosome 9 (position 2032569)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2040812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTCTCATAACGGCATGGCTTTAAAGGAGGAGTTTGAATATATCGG[T/C]GAGATCTTTATCAGTACAGCAGATATTTACATTTATAAGCACAACACAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link