si:ch1073-76a20.1

Ensembl ID:
ENSDARG00000063640
ZFIN ID:
ZDB-GENE-070912-4
Description:
Novel protein similar to H.sapiens CORIN, corin, serine peptidase (CORIN) [Source:UniProtKB/TrEMBL;A
Human Orthologue:
CORIN
Human Description:
corin, serine peptidase [Source:HGNC Symbol;Acc:19012]
Mouse Orthologue:
Corin
Mouse Description:
corin Gene [Source:MGI Symbol;Acc:MGI:1349451]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44057 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104311 Nonsense 339 801 7 18
ENSDART00000135216 Nonsense 209 662 5 16
Genomic Location (Zv9):
Chromosome 23 (position 44132434)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44162525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAATGACCCCTAAATGAATGTATGTTTTGCTGTGCTGCAGTGTGTGAT[G/T]AGCTTGAAGAGCACCACTGTGGGGATGGACGCTGTATTCCTCGAGAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link