galnt11

Ensembl ID:
ENSDARG00000063636
ZFIN ID:
ZDB-GENE-060929-998
Description:
polypeptide N-acetylgalactosaminyltransferase 11 [Source:RefSeq peptide;Acc:NP_001070030]
Human Orthologue:
GALNT11
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11) [So
Mouse Orthologue:
Galnt11
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16956 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093163 Nonsense 27 590 2 12

The following transcripts of ENSDARG00000063636 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 7696732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGTTGCCTCTTCACCTCCGTGACCTGGTCGATTCTTCTGTTMCTCTA[T/A]TTYAAYCTCAGCCAGGAAAGCCGACTATCCTTCAGAAATGTGYCCGTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a6y6e4sd