nrxn1b

Ensembl ID:
ENSDARG00000063635
ZFIN IDs:
ZDB-GENE-070206-3, ZDB-GENE-070206-3
Description:
neurexin-1-beta [Source:RefSeq peptide;Acc:NP_001073428]
Human Orthologue:
NRXN1
Human Description:
neurexin 1 [Source:HGNC Symbol;Acc:8008]
Mouse Orthologue:
Nrxn1
Mouse Description:
neurexin I Gene [Source:MGI Symbol;Acc:MGI:1096391]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35390 Nonsense Mutation detected in F1 DNA During 2017
sa35391 Nonsense Mutation detected in F1 DNA During 2017
sa42109 Nonsense Mutation detected in F1 DNA During 2017
sa18533 Nonsense Available for shipment Available now
sa42110 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42111 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22192 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093098 Nonsense 23 1470 1 20
ENSDART00000093166   None 448 None 7
Genomic Location (Zv9):
Chromosome 13 (position 605420)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 603403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGCTCATCTGCTTTTTATCGGACTAATTGTATGTAAAGCGAACGCT[G/T]GATCTAGTCTCAGGTTTACAGGATCCGACGAACAATGGGTTGCGTTTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093098 Nonsense 405 1470 5 20
ENSDART00000093166   None 448 None 7
Genomic Location (Zv9):
Chromosome 13 (position 616792)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 614775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACAGCCGACCTGCCCGAATCTCCTGTCAGCAACAACTTCATGGGCTG[T/A]CTGAGGGAGGTAAAGAAACTGCCACACCAAATCAGTGCAGGCTGTGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093098 Nonsense 562 1470 7 20
ENSDART00000093166   None 448 None 7
Genomic Location (Zv9):
Chromosome 13 (position 622569)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 620552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTATTCTTCAGTGTTCTCTCTGAACCGCAGGCACCATCTCCATCAACT[C/A]AGTGCGCACCCCGTACCTGTGCCCCGGAGACAGCGAGCTCCTGGATCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093098 Nonsense 897 1470 11 20
ENSDART00000093166   None 448 None 7
Genomic Location (Zv9):
Chromosome 13 (position 632135)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 630118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCAGCTACGTGACGCTRCCGTCTTTACAGGCGTATTACTACATGTA[C/A]CTGTTTTTCCAGTTCAAGACCACCTCCGCAGACGGACTCAYACTCTAYAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093098 Essential Splice Site 1050 1470 13 20
ENSDART00000093166   None 448 None 7
Genomic Location (Zv9):
Chromosome 13 (position 634076)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 632059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGACCGAAGCGCTGGTCTGTGTCGGGCAGATCGAGAGAGGATGTGAAG[G/T]TAATAAACGTTTTTTTAAAAACATTTTACGGTCAGTATTTGTTTTAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093098 Essential Splice Site 1235 1470 17 20
ENSDART00000093166 Essential Splice Site 213 448 4 7
Genomic Location (Zv9):
Chromosome 13 (position 669411)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 667394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTAGACTTCCATATCGGCGGCTAGTTGAAGAATCGCTACCGAAGAACGG[T/C]AAAAACCAGGATAAAGCTTAAGTAATACTATTTTAACAGTTTTAACAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093098 Nonsense 1437 1470 20 20
ENSDART00000093166 Nonsense 415 448 7 7
Genomic Location (Zv9):
Chromosome 13 (position 679900)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 677883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCGCAACCGAGACGAGGGGTCGTACCATGTGGACGAGAGCAGAAACTA[C/A]ATCTGCAACTCCAACGGAGCCGCGCTGAAGGAGAAAAACACTGCAGACGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link