hpse

Ensembl ID:
ENSDARG00000063634
ZFIN ID:
ZDB-GENE-041111-200
Description:
heparanase [Source:RefSeq peptide;Acc:NP_001038470]
Human Orthologue:
HPSE
Human Description:
heparanase [Source:HGNC Symbol;Acc:5164]
Mouse Orthologue:
Hpse
Mouse Description:
heparanase Gene [Source:MGI Symbol;Acc:MGI:1343124]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18312 Nonsense Available for shipment Available now
sa4148 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093155 Nonsense 85 546 2 12
Genomic Location:
Chromosome 21 (position 18163271)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATNNTGTTTTATTGCAGTTCACCAAAGTTAAGAAYCCTCGCCAAAKCTT[T/A]GACCCCAGCCTTTYTGAGATTTGGAGGCRCCAAACAAGATTTTCTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093155 Nonsense 509 546 12 12
Genomic Location:
Chromosome 21 (position 18176309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCAGGTCAGTTCGTCTGAATGGAGAGCTGTTGAAGATGGTGGATGAT[C/T]GAACTCTTCCTCCGCTGACAGGACGTGAGCTGCCGTCTGATGAACCCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/46wxusl4