ch1073-291c23.1

Ensembl ID:
ENSDARG00000063631
ZFIN ID:
ZDB-GENE-050208-114
Description:
Novel protein similar to vertebrate vitrin (VIT) [Source:UniProtKB/TrEMBL;Acc:B8JMF2]
Human Orthologue:
VIT
Human Description:
vitrin [Source:HGNC Symbol;Acc:12697]
Mouse Orthologue:
Vit
Mouse Description:
vitrin Gene [Source:MGI Symbol;Acc:MGI:1921449]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16980 Essential Splice Site Available for shipment Available now
sa1300 Nonsense Available for shipment Available now
sa10205 Essential Splice Site Available for shipment Available now
sa16108 Nonsense Available for shipment Available now
sa22187 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093160 Essential Splice Site 90 770 2 20
ENSDART00000137398 Essential Splice Site 113 762 3 19
Genomic Location:
Chromosome 13 (position 263886)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCGSTCTCTGTCTTTACCCACCTGGAGAGAGTCCTTCTCYRTCTCAGG[T/C]ACTGTAGACTATTCAGGTTCACTTCWWTAGCACTTTCACAATAGCTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093160 Nonsense 300 770 11 20
ENSDART00000137398 Nonsense 292 762 10 19
Genomic Location:
Chromosome 13 (position 256350)
KASP Assay ID:
554-1215.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGTGTTCAGACAGTAGCCAGTCTGTGCCCAACACAGGCTATAAGTG[G/A]AGCCGGACGAGCAGCGGTGACCCCGCAGGTGAGGATCACACACAAATCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093160 Essential Splice Site 540 770 18 20
ENSDART00000137398 Essential Splice Site 532 762 17 19
Genomic Location:
Chromosome 13 (position 247268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGACAACGAGAAGCAGAACGTGGTGGAGAGCAACTTTGTTGACAAGG[T/C]ATTGACATGYASGACTGATCCAGCKAGATTACACGRGCTGGATTCACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093160 Nonsense 631 770 19 20
ENSDART00000137398 Nonsense 623 762 18 19
Genomic Location:
Chromosome 13 (position 246527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGAGTTCGAGATCKCAGACACRGACACCCGWGTGGGCATCGTGCAGTA[C/A]ACSTAYGAGCAGCGGCTGGAGTTCGCTTTCGGACAGCACAACAACAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093160 Nonsense 633 770 19 20
ENSDART00000137398 Nonsense 625 762 18 19
Genomic Location:
Chromosome 13 (position 246521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGAGATCTCAGACACGGACACCCGAGTGGGCATCGTGCAGTACACGTA[C/A]GAGCAGCGGCTGGAGTTCGCTTTCGGACAGCACAACAACAAAGCCGACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2sjg3jyg