bop1

Ensembl ID:
ENSDARG00000063627
ZFIN ID:
ZDB-GENE-030219-109
Description:
Ribosome biogenesis protein bop1 [Source:UniProtKB/Swiss-Prot;Acc:A0JMQ0]
Human Orthologues:
AC145291.1, BOP1
Human Descriptions:
block of proliferation 1 [Source:HGNC Symbol;Acc:15519]
KM-PA-2 protein [Source:UniProtKB/TrEMBL;Acc:Q96Q25]
Mouse Orthologue:
Bop1
Mouse Description:
block of proliferation 1 Gene [Source:MGI Symbol;Acc:MGI:1334460]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36754 Nonsense Mutation detected in F1 DNA During 2017
sa23413 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093146 Nonsense 387 785 8 17
ENSDART00000128061 Nonsense 379 777 8 16
ENSDART00000137020 Nonsense 223 621 5 13
Genomic Location (Zv9):
Chromosome 19 (position 3523077)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3019650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGACCCCGAGGACAGAAAGCTGAGTTTCCTCCCGCAGAAGTTCTCGTG[T/A]CTGCGAGCCGTTCCTGCATTCTCACGCTTCATTCACGAGCGCTTCGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093146 Essential Splice Site 418 785 8 17
ENSDART00000128061 Essential Splice Site 410 777 8 16
ENSDART00000137020 Essential Splice Site 254 621 5 13
Genomic Location (Zv9):
Chromosome 19 (position 3522982)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3019555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGCGCTGCCTCGACCTCTACCTGTGTCCCAGACAGAGGAAGATGAGGG[T/C]GAGCCGTCTCAAACAAACACACTGTTACACACACAAACACACACACGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link