DDX21

Ensembl ID:
ENSDARG00000063626
Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 [Source:HGNC Symbol;Acc:2744]
Human Orthologues:
DDX21, DDX50
Human Descriptions:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 [Source:HGNC Symbol;Acc:2744]
DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 [Source:HGNC Symbol;Acc:17906]
Mouse Orthologues:
Ddx21, Ddx50
Mouse Descriptions:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 Gene [Source:MGI Symbol;Acc:MGI:1860494]
DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 Gene [Source:MGI Symbol;Acc:MGI:2182303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35386 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093149 Essential Splice Site 496 758 10 18
Genomic Location (Zv9):
Chromosome 13 (position 180540)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 193537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGACATCCCAGAGGTGGACCTGGTCATCCAGAGCTCACCACCAAACG[T/C]AAGCATCAGTCAGCATTTACTCAATACACACAACACGCCCTGAATATACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link