btc

Ensembl ID:
ENSDARG00000063625
ZFIN ID:
ZDB-GENE-050311-1
Description:
betacellulin-like [Source:RefSeq peptide;Acc:NP_001154295]
Human Orthologue:
BTC
Human Description:
betacellulin [Source:HGNC Symbol;Acc:1121]
Mouse Orthologue:
Btc
Mouse Description:
betacellulin, epidermal growth factor family member Gene [Source:MGI Symbol;Acc:MGI:99439]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19258 Nonsense Mutation detected in F1 DNA During 2017
sa23902 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093153 Nonsense 133 178 4 6
ENSDART00000101482   None 178 None 5
ENSDART00000112089   None 172 None 4
ENSDART00000140546   None 178 None 6
Genomic Location (Zv9):
Chromosome 21 (position 18188259)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19336511
KASP Assay ID:
2261-5469.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGGTCGCAGGATTGGTGTTTCTGATTCTGCTCATCGTTTTCATTTG[C/A]GTCTGTACACAGTGAGTAGATGCATAATTCTAAAGCATTTTCTTCCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093153 Nonsense 139 178 5 6
ENSDART00000101482   None 178 None 5
ENSDART00000112089   None 172 None 4
ENSDART00000140546   None 178 None 6
Genomic Location (Zv9):
Chromosome 21 (position 18188360)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19336612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGAAGTCTTTTAATTGTATTGTTCTTTGTGTTTTGTTTGACAGTAAA[C/T]GATATAGACCATGTAGAAAAAAGAAGAGAAAGAAGCAAACAATTGATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link