LOC100148912

Ensembl ID:
ENSDARG00000063621
Human Orthologues:
AADAC, AADACL2
Human Descriptions:
arylacetamide deacetylase (esterase) [Source:HGNC Symbol;Acc:17]
arylacetamide deacetylase-like 2 [Source:HGNC Symbol;Acc:24427]
Mouse Orthologues:
Aadac, Aadacl2, AC138585.1, C130079G13Rik, Gm9696
Mouse Descriptions:
arylacetamide deacetylase (esterase) Gene [Source:MGI Symbol;Acc:MGI:1915008]
arylacetamide deacetylase-like 2 Gene [Source:MGI Symbol;Acc:MGI:3646333]
predicted gene 5538 (Gm5538), mRNA [Source:RefSeq DNA;Acc:NM_001101531]
predicted gene 9696 Gene [Source:MGI Symbol;Acc:MGI:3819177]
RIKEN cDNA C130079G13 gene Gene [Source:MGI Symbol;Acc:MGI:3028051]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22566 Nonsense Mutation detected in F1 DNA During 2014
sa10917 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093133 Nonsense 30 411 1 5
Genomic Location:
Chromosome 15 (position 1061837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCGCGTTGACAGCTTATCACGTTTATTCACCAATCCCGAGTGACATT[G/T]AGGAGAGATGGAAACTAATGGTCACAGACTCCTTCTTCAAAAGTTTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093133 Essential Splice Site 125 411 2 5
Genomic Location:
Chromosome 15 (position 1054534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCCATCAWTTACTTGCWTGGAGGCGGATGGTGTCTCGGCAGCTCTCG[T/C]GAGTACCATTAAATRTGCKCGAAATTAGGGCTGCATGATTAATTRAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m8kkf96q