LOC100148912

Ensembl ID:
ENSDARG00000063621
Human Orthologues:
AADAC, AADACL2
Human Descriptions:
arylacetamide deacetylase (esterase) [Source:HGNC Symbol;Acc:17]
arylacetamide deacetylase-like 2 [Source:HGNC Symbol;Acc:24427]
Mouse Orthologues:
Aadac, Aadacl2, AC138585.1, C130079G13Rik, Gm9696
Mouse Descriptions:
arylacetamide deacetylase (esterase) Gene [Source:MGI Symbol;Acc:MGI:1915008]
arylacetamide deacetylase-like 2 Gene [Source:MGI Symbol;Acc:MGI:3646333]
predicted gene 5538 (Gm5538), mRNA [Source:RefSeq DNA;Acc:NM_001101531]
predicted gene 9696 Gene [Source:MGI Symbol;Acc:MGI:3819177]
RIKEN cDNA C130079G13 gene Gene [Source:MGI Symbol;Acc:MGI:3028051]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22566 Nonsense Mutation detected in F1 DNA During 2016
sa32008 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10917 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093133 Nonsense 30 411 1 5
Genomic Location (Zv9):
Chromosome 15 (position 1061837)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1105045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCGCGTTGACAGCTTATCACGTTTATTCACCAATCCCGAGTGACATT[G/T]AGGAGAGATGGAAACTAATGGTCACAGACTCCTTCTTCAAAAGTTTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093133 Essential Splice Site 48 411 1 5
Genomic Location (Zv9):
Chromosome 15 (position 1061779)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1104987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAAACTAATGGTCACAGACTCCTTCTTCAAAAGTTTGAGCCAGCTGG[T/C]GAGTTTGCTTATTTACCGAGCTAGCAGCCTGTGGGATTGACAAGCCGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093133 Essential Splice Site 125 411 2 5
Genomic Location (Zv9):
Chromosome 15 (position 1054534)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1096673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCCATCAWTTACTTGCWTGGAGGCGGATGGTGTCTCGGCAGCTCTCG[T/C]GAGTACCATTAAATRTGCKCGAAATTAGGGCTGCATGATTAATTRAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link